Transcript: Human NM_144994.8

Homo sapiens ankyrin repeat domain 23 (ANKRD23), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ANKRD23 (200539)
Length:
2584
CDS:
30..947

Additional Resources:

NCBI RefSeq record:
NM_144994.8
NBCI Gene record:
ANKRD23 (200539)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144994.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149891 GCTCTAGACAACTTTGGTCAT pLKO.1 1543 3UTR 100% 4.050 5.670 N ANKRD23 n/a
2 TRCN0000245645 CATGGGTCCTGGGTTACATTA pLKO_005 2240 3UTR 100% 13.200 9.240 N ANKRD23 n/a
3 TRCN0000245641 GATTTAACAGTACCAGATTTA pLKO_005 211 CDS 100% 13.200 9.240 N ANKRD23 n/a
4 TRCN0000245644 CCACCTGAACGCACAGGATAA pLKO_005 731 CDS 100% 10.800 7.560 N ANKRD23 n/a
5 TRCN0000245643 GACATCTGGTCATCCTCAAAC pLKO_005 592 CDS 100% 10.800 7.560 N ANKRD23 n/a
6 TRCN0000146674 CTGATTGACAAGTACTTGACA pLKO.1 405 CDS 100% 3.000 2.100 N ANKRD23 n/a
7 TRCN0000245642 GAAGGGAAAGTGTTGGGATTT pLKO_005 75 CDS 100% 10.800 6.480 N ANKRD23 n/a
8 TRCN0000147438 GCTGAAATTGGAAGAAGAGAA pLKO.1 173 CDS 100% 4.950 2.970 N ANKRD23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144994.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05188 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05188 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468423 AGATGTTTGCTGATACTGACCGTC pLX_317 37.2% 100% 100% V5 n/a
Download CSV