Transcript: Human NM_145005.6

Homo sapiens C9orf72-SMCR8 complex subunit (C9orf72), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
C9orf72 (203228)
Length:
1957
CDS:
125..793

Additional Resources:

NCBI RefSeq record:
NM_145005.6
NBCI Gene record:
C9orf72 (203228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145005.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149351 GCCAAGACAGAGATTGCTTTA pLKO.1 161 CDS 100% 10.800 7.560 N C9orf72 n/a
2 TRCN0000148881 CCACTTCATAGAGTGTGTGTT pLKO.1 500 CDS 100% 4.950 3.465 N C9orf72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145005.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05210 pDONR223 100% 46% 45.9% None 666_666delGins778 n/a
2 ccsbBroad304_05210 pLX_304 0% 46% 45.9% V5 666_666delGins778 n/a
3 TRCN0000471027 CTCATTGCAGACATACATACAACT pLX_317 30% 46% 45.9% V5 666_666delGins778 n/a
Download CSV