Transcript: Human NM_145166.4

Homo sapiens zinc finger and BTB domain containing 47 (ZBTB47), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZBTB47 (92999)
Length:
5494
CDS:
269..2512

Additional Resources:

NCBI RefSeq record:
NM_145166.4
NBCI Gene record:
ZBTB47 (92999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145166.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000447489 AGCCGTACATCTGCGAGATCT pLKO_005 2157 CDS 100% 4.950 3.465 N ZBTB47 n/a
2 TRCN0000107924 CCATGAGCATAACAAGATTGT pLKO.1 1783 CDS 100% 4.950 3.465 N ZBTB47 n/a
3 TRCN0000107920 CCTGCTTTACTGTAGCTCTTT pLKO.1 4308 3UTR 100% 4.950 3.465 N ZBTB47 n/a
4 TRCN0000107921 GAAGCCGTTCAGATGTGAGAA pLKO.1 1987 CDS 100% 4.950 3.465 N ZBTB47 n/a
5 TRCN0000428941 GCAGATCCTCAACTTCATCTA pLKO_005 472 CDS 100% 4.950 3.465 N ZBTB47 n/a
6 TRCN0000107922 GAAGAAGTTCTCATGCGAGAT pLKO.1 1819 CDS 100% 4.050 2.835 N ZBTB47 n/a
7 TRCN0000107923 GTCACACATGAGCATCCACAT pLKO.1 2044 CDS 100% 4.050 2.835 N ZBTB47 n/a
8 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1209 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145166.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12986 pDONR223 100% 49.6% 49.6% None 1_1128del n/a
2 ccsbBroad304_12986 pLX_304 0% 49.6% 49.6% V5 1_1128del n/a
3 TRCN0000479175 TCCCGATCGGGCTCTAACACCTGA pLX_317 40.1% 49.6% 49.6% V5 1_1128del n/a
Download CSV