Transcript: Human NM_145290.4

Homo sapiens adhesion G protein-coupled receptor A3 (ADGRA3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ADGRA3 (166647)
Length:
4577
CDS:
283..4248

Additional Resources:

NCBI RefSeq record:
NM_145290.4
NBCI Gene record:
ADGRA3 (166647)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138388 CCCAACTCTAATGGGACGAAT pLKO.1 3511 CDS 100% 4.950 6.930 N ADGRA3 n/a
2 TRCN0000136707 GCGCCTTTAGAAGTTCAGTTT pLKO.1 3748 CDS 100% 4.950 6.930 N ADGRA3 n/a
3 TRCN0000138161 CCTGAGCGCAAATATGAGCTT pLKO.1 3118 CDS 100% 2.640 2.112 N ADGRA3 n/a
4 TRCN0000238972 AGACACCCTGAGCGCAAATAT pLKO_005 3112 CDS 100% 15.000 10.500 N Adgra3 n/a
5 TRCN0000136842 CCAGCCTTACTTTGCTCTTAT pLKO.1 3278 CDS 100% 13.200 9.240 N ADGRA3 n/a
6 TRCN0000135701 CCTTGAAGCTATGAGCATTTA pLKO.1 4300 3UTR 100% 13.200 9.240 N ADGRA3 n/a
7 TRCN0000136968 CCAGGGCTGCAAATTAACAAA pLKO.1 3612 CDS 100% 5.625 3.938 N ADGRA3 n/a
8 TRCN0000138744 CCTCTGATCGTACAGGACTTT pLKO.1 1976 CDS 100% 4.950 3.465 N ADGRA3 n/a
9 TRCN0000135417 GTGATACTCACATTCCTTGAA pLKO.1 4286 3UTR 100% 4.950 3.465 N ADGRA3 n/a
10 TRCN0000137426 GCAAGTAACATCATGTTGGCT pLKO.1 1750 CDS 100% 0.750 0.525 N ADGRA3 n/a
11 TRCN0000138303 CAGCCACCATAGGGATTCAAA pLKO.1 4332 3UTR 100% 5.625 3.375 N ADGRA3 n/a
12 TRCN0000136706 GCAGCAGCGAACATTAAGAAT pLKO.1 2959 CDS 100% 5.625 3.375 N ADGRA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13344 pDONR223 100% 28.4% 27.7% None (many diffs) n/a
2 ccsbBroad304_13344 pLX_304 0% 28.4% 27.7% V5 (many diffs) n/a
Download CSV