Transcript: Mouse NM_145383.1

Mus musculus rhodopsin (Rho), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rho (212541)
Length:
3249
CDS:
79..1125

Additional Resources:

NCBI RefSeq record:
NM_145383.1
NBCI Gene record:
Rho (212541)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026336 CATTCCTATGATCGTCATCTT pLKO.1 717 CDS 100% 4.950 6.930 N Rho n/a
2 TRCN0000026406 CATGCAATGTTCATGCGGGAT pLKO.1 624 CDS 100% 2.160 3.024 N Rho n/a
3 TRCN0000026364 CATCTATAACCCGGTCATCTA pLKO.1 975 CDS 100% 4.950 3.465 N Rho n/a
4 TRCN0000026389 CGAATCCTTTGTCATCTACAT pLKO.1 678 CDS 100% 4.950 3.465 N Rho n/a
5 TRCN0000026375 TGTGGTCTTCACCTGGATCAT pLKO.1 546 CDS 100% 4.950 3.465 N Rho n/a
6 TRCN0000003751 CATCAACTTCCTCACGCTCTA pLKO.1 237 CDS 100% 4.050 2.835 N RHO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488933 AGTTCATCGCAAGCACCCGTTTCT pLX_317 35.4% 88.3% 94.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV