Transcript: Mouse NM_145405.2

Mus musculus ubiquitin-like 4A (Ubl4a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ubl4a (27643)
Length:
2334
CDS:
86..559

Additional Resources:

NCBI RefSeq record:
NM_145405.2
NBCI Gene record:
Ubl4a (27643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248968 GAACAACTACAGAGGGATTAT pLKO_005 434 CDS 100% 13.200 6.600 Y Ubl4a n/a
2 TRCN0000248967 TAAGCTCAACCTAGTTGTTAA pLKO_005 280 CDS 100% 13.200 6.600 Y Ubl4a n/a
3 TRCN0000248965 GAAGCACCTGGTCTCGGATAA pLKO_005 163 CDS 100% 10.800 5.400 Y Ubl4a n/a
4 TRCN0000248966 GACTGTCAGATTACAACATTG pLKO_005 249 CDS 100% 10.800 5.400 Y Ubl4a n/a
5 TRCN0000248964 CTGGATGACATCGAACGTTTG pLKO_005 479 CDS 100% 6.000 3.000 Y Ubl4a n/a
6 TRCN0000007669 GCAGCTGATCTCCAAAGTCTT pLKO.1 373 CDS 100% 4.950 2.475 Y UBL4A n/a
7 TRCN0000277750 GCAGCTGATCTCCAAAGTCTT pLKO_005 373 CDS 100% 4.950 2.475 Y UBL4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01878 pDONR223 100% 85.6% 89.8% None (many diffs) n/a
2 ccsbBroad304_01878 pLX_304 0% 85.6% 89.8% V5 (many diffs) n/a
3 TRCN0000466142 ACCGAAGAATAATCGTTTGCGATC pLX_317 75.9% 85.6% 89.8% V5 (many diffs) n/a
Download CSV