Transcript: Mouse NM_145423.2

Mus musculus solute carrier family 5 (iodide transporter), member 8 (Slc5a8), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slc5a8 (216225)
Length:
5346
CDS:
316..2151

Additional Resources:

NCBI RefSeq record:
NM_145423.2
NBCI Gene record:
Slc5a8 (216225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070351 CGAGTATTTGGAACTTCGATT pLKO.1 663 CDS 100% 4.950 6.930 N Slc5a8 n/a
2 TRCN0000070348 GCAGAGATATATTTCCTGTAA pLKO.1 1107 CDS 100% 4.950 6.930 N Slc5a8 n/a
3 TRCN0000070349 CCGTAATTATACAGGCATCAA pLKO.1 920 CDS 100% 4.950 3.960 N Slc5a8 n/a
4 TRCN0000070350 CCTTGAAACCTATGGCTGTAA pLKO.1 1737 CDS 100% 4.950 3.465 N Slc5a8 n/a
5 TRCN0000070352 CCTGTGGAAGTTGGTGGAAAT pLKO.1 2056 CDS 100% 10.800 5.400 Y Slc5a8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09732 pDONR223 100% 86% 86.4% None (many diffs) n/a
2 ccsbBroad304_09732 pLX_304 0% 86% 86.4% V5 (many diffs) n/a
3 TRCN0000472672 AACCAGACCGTATATGCGCCGCGA pLX_317 19.9% 86% 86.4% V5 (many diffs) n/a
Download CSV