Transcript: Mouse NM_145424.2

Mus musculus RDH16 family member 2 (Rdh16f2), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Rdh16f2 (216454)
Length:
1281
CDS:
81..1037

Additional Resources:

NCBI RefSeq record:
NM_145424.2
NBCI Gene record:
Rdh16f2 (216454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414325 TTTGTGTTGTTGGGTCAATGG pLKO_005 1050 3UTR 100% 4.050 5.670 N Rdh16f2 n/a
2 TRCN0000041454 GCTGAGGAGAAAGACATCAGA pLKO.1 284 CDS 100% 3.000 2.100 N Rdh16f2 n/a
3 TRCN0000041455 GAGAGGCAAGTGGTGGACCAT pLKO.1 138 CDS 100% 0.880 0.616 N Rdh16f2 n/a
4 TRCN0000438109 AGAGTGTCACTTGGTGGTAGT pLKO_005 582 CDS 100% 4.050 2.430 N Rdh16f2 n/a
5 TRCN0000041453 AGGAGGAGGAAGATTCCTGTT pLKO.1 1098 3UTR 100% 4.050 2.430 N Rdh16f2 n/a
6 TRCN0000041457 GAGAAAGACATCAGAAAGGCT pLKO.1 290 CDS 100% 0.750 0.450 N Rdh16f2 n/a
7 TRCN0000445030 GGGTGAAGGTGGCTATTATAG pLKO_005 676 CDS 100% 13.200 6.600 Y Rdh16 n/a
8 TRCN0000041456 GTGCCAGATTATGCTCAAATA pLKO.1 730 CDS 100% 13.200 6.600 Y Rdh16f2 n/a
9 TRCN0000041946 CAGCTCAGAAATCAGGGAGAT pLKO.1 773 CDS 100% 4.050 2.025 Y Rdh16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.