Transcript: Mouse NM_145491.2

Mus musculus ras homolog family member Q (Rhoq), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rhoq (104215)
Length:
4159
CDS:
496..1113

Additional Resources:

NCBI RefSeq record:
NM_145491.2
NBCI Gene record:
Rhoq (104215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145491.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077514 GCTAAAGGAATATGCGCCAAA pLKO.1 813 CDS 100% 4.050 5.670 N Rhoq n/a
2 TRCN0000316799 GCTAAAGGAATATGCGCCAAA pLKO_005 813 CDS 100% 4.050 5.670 N Rhoq n/a
3 TRCN0000077513 GCCAAGTTGAATAGATCATAA pLKO.1 1732 3UTR 100% 13.200 9.240 N Rhoq n/a
4 TRCN0000316800 GCCAAGTTGAATAGATCATAA pLKO_005 1732 3UTR 100% 13.200 9.240 N Rhoq n/a
5 TRCN0000077516 CAGTACCTCTTGGGACTCTAT pLKO.1 661 CDS 100% 4.950 3.465 N Rhoq n/a
6 TRCN0000316869 CAGTACCTCTTGGGACTCTAT pLKO_005 661 CDS 100% 4.950 3.465 N Rhoq n/a
7 TRCN0000077515 GCAAGACTGAATGACATGAAA pLKO.1 892 CDS 100% 5.625 3.375 N Rhoq n/a
8 TRCN0000316868 GCAAGACTGAATGACATGAAA pLKO_005 892 CDS 100% 5.625 3.375 N Rhoq n/a
9 TRCN0000047592 ACTCAGATTGATCTCCGAGAT pLKO.1 856 CDS 100% 4.050 2.430 N RHOQ n/a
10 TRCN0000289570 ACTCAGATTGATCTCCGAGAT pLKO_005 856 CDS 100% 4.050 2.430 N RHOQ n/a
11 TRCN0000077517 TGTGTTTGATGAGGCTATCAT pLKO.1 1014 CDS 100% 5.625 2.813 Y Rhoq n/a
12 TRCN0000316867 TGTGTTTGATGAGGCTATCAT pLKO_005 1014 CDS 100% 5.625 2.813 Y Rhoq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145491.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02767 pDONR223 100% 94.1% 99.5% None (many diffs) n/a
2 ccsbBroad304_02767 pLX_304 0% 94.1% 99.5% V5 (many diffs) n/a
3 TRCN0000468701 ATATGACCATCACTCATCACCCGG pLX_317 66.1% 94.1% 99.5% V5 (many diffs) n/a
Download CSV