Transcript: Mouse NM_145492.4

Mus musculus zinc finger protein 521 (Zfp521), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Zfp521 (225207)
Length:
6152
CDS:
235..4170

Additional Resources:

NCBI RefSeq record:
NM_145492.4
NBCI Gene record:
Zfp521 (225207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312871 TTGTACAAATTCGCCAATATT pLKO_005 1926 CDS 100% 15.000 21.000 N Zfp521 n/a
2 TRCN0000349770 ATACCGGAAACTGTCGTATTT pLKO_005 3191 CDS 100% 13.200 18.480 N Zfp521 n/a
3 TRCN0000312870 GTCTTACCCTCACTCTATAAC pLKO_005 1567 CDS 100% 13.200 18.480 N Zfp521 n/a
4 TRCN0000086283 CGGCCCATATATATATTTGTA pLKO.1 4680 3UTR 100% 5.625 7.875 N Zfp521 n/a
5 TRCN0000086284 GCCCTGAATTATATTCACAAT pLKO.1 2005 CDS 100% 4.950 6.930 N Zfp521 n/a
6 TRCN0000349769 CATCTGGATACGGCCCATATA pLKO_005 4670 3UTR 100% 13.200 9.240 N Zfp521 n/a
7 TRCN0000086285 GCCCTCAGTGTAACAAAGAAT pLKO.1 2231 CDS 100% 5.625 3.938 N Zfp521 n/a
8 TRCN0000086286 CGGCTGTGTGAATCTCAGTAA pLKO.1 3516 CDS 100% 4.950 3.465 N Zfp521 n/a
9 TRCN0000086287 CCCTCAGTGTAACAAAGAATT pLKO.1 2232 CDS 100% 0.000 0.000 N Zfp521 n/a
10 TRCN0000311881 CCCTCAGTGTAACAAAGAATT pLKO_005 2232 CDS 100% 0.000 0.000 N Zfp521 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466255 GTGGTTTGCAATCGTTCGATCATA pLX_317 9.7% 88.1% 97.3% V5 (many diffs) n/a
Download CSV