Transcript: Mouse NM_145554.2

Mus musculus low density lipoprotein receptor adaptor protein 1 (Ldlrap1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ldlrap1 (100017)
Length:
2671
CDS:
105..1031

Additional Resources:

NCBI RefSeq record:
NM_145554.2
NBCI Gene record:
Ldlrap1 (100017)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241939 TATCTACAGTCAGCGCTAATA pLKO_005 769 CDS 100% 13.200 18.480 N Ldlrap1 n/a
2 TRCN0000241936 TAGACATGGGACGGACCATAA pLKO_005 1062 3UTR 100% 10.800 8.640 N Ldlrap1 n/a
3 TRCN0000176336 CCTGAATCTCAGCCAAACTAA pLKO.1 2318 3UTR 100% 5.625 4.500 N Ldlrap1 n/a
4 TRCN0000173922 GCATCCTGAATCTCAGCCAAA pLKO.1 2314 3UTR 100% 4.050 3.240 N Ldlrap1 n/a
5 TRCN0000241935 CATCGAGAACGTGTCCATTTA pLKO_005 422 CDS 100% 13.200 9.240 N Ldlrap1 n/a
6 TRCN0000176102 GAACGTGTCCATTTACAGGAT pLKO.1 428 CDS 100% 2.640 1.848 N Ldlrap1 n/a
7 TRCN0000241937 TACCGGGAACCTGCTGGATTT pLKO_005 725 CDS 100% 0.000 0.000 N Ldlrap1 n/a
8 TRCN0000241938 TCAGCACAGGACATCCATTAT pLKO_005 930 CDS 100% 13.200 7.920 N Ldlrap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11812 pDONR223 100% 72.8% 75.3% None (many diffs) n/a
2 ccsbBroad304_11812 pLX_304 0% 72.8% 75.3% V5 (many diffs) n/a
3 TRCN0000472559 TTATTCTGCGCAGCTCAGATTGTC pLX_317 56.2% 72.8% 75.3% V5 (many diffs) n/a
Download CSV