Transcript: Mouse NM_145584.2

Mus musculus spondin 1, (f-spondin) extracellular matrix protein (Spon1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Spon1 (233744)
Length:
6166
CDS:
332..2755

Additional Resources:

NCBI RefSeq record:
NM_145584.2
NBCI Gene record:
Spon1 (233744)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090522 GACCTATGAGTCACCAAACAA pLKO.1 1414 CDS 100% 5.625 3.938 N Spon1 n/a
2 TRCN0000090518 GCAGGTGATGATGGCTACTTT pLKO.1 3349 3UTR 100% 5.625 3.938 N Spon1 n/a
3 TRCN0000090520 GCCAAGTACAGACTCACGTTT pLKO.1 944 CDS 100% 4.950 3.465 N Spon1 n/a
4 TRCN0000090521 GCGCTACATGACTGTGAAGAA pLKO.1 2659 CDS 100% 4.950 3.465 N Spon1 n/a
5 TRCN0000090519 CGTGACCTATGAGTCACCAAA pLKO.1 1411 CDS 100% 0.495 0.347 N Spon1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07603 pDONR223 100% 89.7% 96.2% None (many diffs) n/a
2 ccsbBroad304_07603 pLX_304 0% 89.7% 96.2% V5 (many diffs) n/a
3 TRCN0000477549 ACGCCGGAACTGGTCTCCTGACCT pLX_317 18.1% 89.7% 96.2% V5 (many diffs) n/a
Download CSV