Transcript: Mouse NM_145621.2

Mus musculus CaM kinase-like vesicle-associated (Camkv), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Camkv (235604)
Length:
3031
CDS:
142..1680

Additional Resources:

NCBI RefSeq record:
NM_145621.2
NBCI Gene record:
Camkv (235604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145621.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362221 CTCCGTACTGGGACGATATTT pLKO_005 887 CDS 100% 15.000 21.000 N Camkv n/a
2 TRCN0000362222 TGACTATGAGAACCACGATAA pLKO_005 822 CDS 100% 10.800 15.120 N Camkv n/a
3 TRCN0000024175 CGCGGCTTCTGATAAGAACAT pLKO.1 1008 CDS 100% 4.950 6.930 N Camkv n/a
4 TRCN0000024176 CCACCCTCTAGTAAAGGAGAA pLKO.1 1612 CDS 100% 4.050 5.670 N Camkv n/a
5 TRCN0000024174 CGCAAGGAATACTTCATCTTT pLKO.1 415 CDS 100% 5.625 4.500 N Camkv n/a
6 TRCN0000362223 ATCCTTTCCCAGGCCCTAAAT pLKO_005 2048 3UTR 100% 13.200 9.240 N Camkv n/a
7 TRCN0000362144 CCATTGGCGTCATCATGTATA pLKO_005 755 CDS 100% 13.200 9.240 N Camkv n/a
8 TRCN0000024177 GCTGCACACCTGTAAGAAGTT pLKO.1 285 CDS 100% 4.950 3.465 N Camkv n/a
9 TRCN0000024178 GCTAAGCTAGAGAATGGCCTT pLKO.1 649 CDS 100% 2.160 1.512 N Camkv n/a
10 TRCN0000010257 GAGCAAGACCAGCGGATCACT pLKO.1 949 CDS 100% 1.000 0.700 N CAMKV n/a
11 TRCN0000338351 GAGCAAGACCAGCGGATCACT pLKO_005 949 CDS 100% 1.000 0.700 N CAMKV n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145621.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08905 pDONR223 100% 87.8% 92.6% None (many diffs) n/a
2 ccsbBroad304_08905 pLX_304 0% 87.8% 92.6% V5 (many diffs) n/a
3 TRCN0000470705 TTCGAGTATTGTATCTAGCTCCCG pLX_317 27.9% 87.8% 92.6% V5 (many diffs) n/a
4 ccsbBroadEn_15144 pDONR223 0% 87.8% 92.6% None (many diffs) n/a
5 ccsbBroad304_15144 pLX_304 0% 87.8% 92.6% V5 (many diffs) n/a
6 TRCN0000480536 TCCTCTTTAGGCTTTAACAAGCTC pLX_317 27.9% 87.8% 92.6% V5 (many diffs) n/a
7 ccsbBroadEn_15976 pDONR223 0% 87.8% 92.4% None (many diffs) n/a
8 ccsbBroad304_15976 pLX_304 0% 87.8% 92.4% V5 (many diffs) n/a
9 TRCN0000468820 GGACTTTCAGGCCCATTATAGCAA pLX_317 23.9% 87.8% 92.4% V5 (many diffs) n/a
Download CSV