Transcript: Mouse NM_145704.2

Mus musculus Kv channel-interacting protein 2 (Kcnip2), transcript variant c, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Kcnip2 (80906)
Length:
2264
CDS:
261..923

Additional Resources:

NCBI RefSeq record:
NM_145704.2
NBCI Gene record:
Kcnip2 (80906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145704.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069759 GCTGGTTTGTCAGTGATTCTT pLKO.1 609 CDS 100% 5.625 4.500 N Kcnip2 n/a
2 TRCN0000069760 CGAGATTTGGACGGCTCCTAT pLKO.1 300 CDS 100% 4.950 3.960 N Kcnip2 n/a
3 TRCN0000069758 CGAGGAGAACTTCAAGCAAAT pLKO.1 482 CDS 100% 10.800 7.560 N Kcnip2 n/a
4 TRCN0000069762 CGACATCATGAAGTCCATCTA pLKO.1 716 CDS 100% 4.950 3.465 N Kcnip2 n/a
5 TRCN0000069761 GCCTTTGACACCAACCATGAT pLKO.1 561 CDS 100% 4.950 3.465 N Kcnip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145704.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03136 pDONR223 100% 79.8% 84.5% None (many diffs) n/a
2 ccsbBroad304_03136 pLX_304 0% 79.8% 84.5% V5 (many diffs) n/a
3 TRCN0000472305 TCCACACCAAATTTCAATAGGCGC pLX_317 63.9% 79.8% 84.5% V5 (many diffs) n/a
Download CSV