Transcript: Mouse NM_145706.2

Mus musculus nucleoporin 43 (Nup43), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nup43 (69912)
Length:
1290
CDS:
59..1201

Additional Resources:

NCBI RefSeq record:
NM_145706.2
NBCI Gene record:
Nup43 (69912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194375 CTGCCAAAGACCGAATTGAAA pLKO.1 1062 CDS 100% 5.625 7.875 N Nup43 n/a
2 TRCN0000247918 ATCAGTTACTGTGCGATATTA pLKO_005 252 CDS 100% 15.000 12.000 N Nup43 n/a
3 TRCN0000247914 AGGATGGAATGTTGAGTATTT pLKO_005 771 CDS 100% 13.200 10.560 N Nup43 n/a
4 TRCN0000247915 CTGTCAGAACTATAGATAATG pLKO_005 546 CDS 100% 13.200 10.560 N Nup43 n/a
5 TRCN0000247917 TGGAGAGGATGGCCGAATAAA pLKO_005 499 CDS 100% 15.000 10.500 N Nup43 n/a
6 TRCN0000247916 GCGTTTCACTGTGGTCTATTG pLKO_005 186 CDS 100% 10.800 7.560 N Nup43 n/a
7 TRCN0000137036 CACTGTGGTCTATTGGAGATT pLKO.1 192 CDS 100% 4.950 3.465 N NUP43 n/a
8 TRCN0000133881 CCGAATTGAAATCACAAGCTT pLKO.1 1072 CDS 100% 3.000 2.100 N NUP43 n/a
9 TRCN0000292273 CCGAATTGAAATCACAAGCTT pLKO_005 1072 CDS 100% 3.000 2.100 N NUP43 n/a
10 TRCN0000193661 CTTTCCTGTCACATAGCTTAA pLKO.1 987 CDS 100% 10.800 6.480 N Nup43 n/a
11 TRCN0000173626 GAACTGATGCAGAAGCCATTT pLKO.1 1155 CDS 100% 10.800 5.400 Y Nup43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05518 pDONR223 100% 88.8% 93.6% None (many diffs) n/a
2 ccsbBroad304_05518 pLX_304 0% 88.8% 93.6% V5 (many diffs) n/a
3 TRCN0000467607 CCTAACTCCGCTCCAAGGCTAGCG pLX_317 39.2% 88.8% 93.6% V5 (many diffs) n/a
Download CSV