Construct: ORF TRCN0000467607
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017505.1_s317c1
- Derived from:
- ccsbBroadEn_05518
- DNA Barcode:
- CCTAACTCCGCTCCAAGGCTAGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NUP43 (348995)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467607
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 348995 | NUP43 | nucleoporin 43 | NM_198887.3 | 100% | 100% | |
| 2 | human | 348995 | NUP43 | nucleoporin 43 | XM_011535798.3 | 86.2% | 82.5% | (many diffs) |
| 3 | human | 348995 | NUP43 | nucleoporin 43 | XM_005266960.5 | 83.3% | 76.3% | (many diffs) |
| 4 | human | 348995 | NUP43 | nucleoporin 43 | XM_005266961.4 | 83.3% | 76.3% | (many diffs) |
| 5 | human | 348995 | NUP43 | nucleoporin 43 | XM_011535799.3 | 82.8% | 80.5% | (many diffs) |
| 6 | human | 348995 | NUP43 | nucleoporin 43 | XM_005266962.4 | 81.8% | 79% | (many diffs) |
| 7 | human | 348995 | NUP43 | nucleoporin 43 | NR_104456.2 | 51.9% | 1_34del;1175_2196del | |
| 8 | human | 348995 | NUP43 | nucleoporin 43 | XR_942420.3 | 51.5% | (many diffs) | |
| 9 | human | 348995 | NUP43 | nucleoporin 43 | XR_001743393.2 | 26.3% | 1_9delGCTTTCGGC;511_512ins136;1014_3670del | |
| 10 | mouse | 69912 | Nup43 | nucleoporin 43 | NM_145706.2 | 88.8% | 93.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1206
- ORF length:
- 1140
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggaaatttat gcgaagtttg tgtcccagaa aatcagcaaa acccgctggc 121 gaccgctgcc tccgggaagt ttacagaccg cggagacgtt cgctacagga tcttgggaca 181 atgaggaaaa ttatatttca ctgtggtcta ttggagattt tggaaacttg gactctgatg 241 gagggtttga aggagaccat cagttattgt gtgatatcag acaccatggt gatgtaatgg 301 atttacagtt ttttgaccag gaaagaattg tcgctgcttc atcaacagga tgtgtaacag 361 ttttccttca ccatccaaat aaccagactc tgtcagtcaa ccagcagtgg actacagctc 421 actaccacac aggccctggc agtccttcct atagcagtgc accatgtaca ggtgttgtgt 481 gcaacaaccc agaaatcgtt acagttggag aggatggtcg aataaatctc ttcagagctg 541 atcacaagga agctgtaaga accatagaca atgcagatag tagtacactc catgctgtaa 601 cctttcttcg aactcctgag attcttactg taaattcaat tggacagttg aaaatatggg 661 atttcagaca acaaggaaat gagccttctc agatattgtc actgactggt gaccgagtgc 721 cactccactg tgttgataga catcccaacc aacagcatgt tGTAGCTACT GGTGGCCAAG 781 ATGGAATGTT GAGTATTTGG GATGTTAGAC AAGGTACTAT GCCTGTATCT CTGCTGAAGG 841 CTCATGAAGC TGAAATGTGG GAAGTTCACT TTCACCCATC CAACCCAGAA CATCTTTTTA 901 CCTGCTCTGA AGATGGATCC CTCTGGCACT GGGATGCTTC CACAGATGTA CCTGAAAAGT 961 CGTCACTCTT TCACCAAGGA GGAAGAAGCA GTACTTTTTT GTCTCATAGC ATTAGTAACC 1021 AAGCTAATGT TCACCAGTCT GTCATTAGCT CCTGGCTCAG CACTGATCCT GCAAAAGACC 1081 GAATTGAAAT CACAAGCTTA CTTCCCAGTA GGTCTCTGTC TGTGAACACT TTGGATGTTT 1141 TAGGTCCTTG TCTTGTTTGT GGAACCGATG CAGAAGCAAT TTATGTTACT AGACATCTTT 1201 TTTCGTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1261 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1321 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACCTAACTCC GCTCCAAGGC TAGCGACGCG 1381 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt