Transcript: Human NM_145731.3

Homo sapiens synaptogyrin 1 (SYNGR1), transcript variant 1b, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SYNGR1 (9145)
Length:
1341
CDS:
63..638

Additional Resources:

NCBI RefSeq record:
NM_145731.3
NBCI Gene record:
SYNGR1 (9145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262683 TCTTGGCTGTTCTCCATAGTG pLKO_005 156 CDS 100% 4.950 3.960 N SYNGR1 n/a
2 TRCN0000011951 GTTCTGCATCTACAACCGCAA pLKO.1 233 CDS 100% 2.160 1.728 N Syngr1 n/a
3 TRCN0000163049 GTTCTGCATCTACAACCGCAA pLKO.1 233 CDS 100% 2.160 1.728 N SYNGR1 n/a
4 TRCN0000281556 AGCGTCAAGGACCGCAAGAAA pLKO_005 351 CDS 100% 5.625 3.938 N SYNGR1 n/a
5 TRCN0000282376 ACGTGTACTTCCCGCAGATCA pLKO_005 328 CDS 100% 4.950 3.465 N SYNGR1 n/a
6 TRCN0000281557 GAGGAGTTCTGCATCTACAAC pLKO_005 228 CDS 100% 4.950 3.465 N SYNGR1 n/a
7 TRCN0000429512 GAACGAGGGCTACCTCAACAA pLKO_005 194 CDS 100% 4.950 3.465 N Syngr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07365 pDONR223 100% 99.8% 100% None 573G>C n/a
2 ccsbBroad304_07365 pLX_304 0% 99.8% 100% V5 573G>C n/a
3 TRCN0000472291 CGCACATCAAGTCCCCAGTTCGTG pLX_317 72.1% 99.8% 100% V5 573G>C n/a
Download CSV