Transcript: Mouse NM_145819.2

Mus musculus myeloid zinc finger 1 (Mzf1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Mzf1 (109889)
Length:
3497
CDS:
325..2532

Additional Resources:

NCBI RefSeq record:
NM_145819.2
NBCI Gene record:
Mzf1 (109889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321551 AGCTTGATGGACCTCGGAAAT pLKO_005 701 CDS 100% 10.800 15.120 N Mzf1 n/a
2 TRCN0000321554 TCCGGTATGAGGATGCAATAG pLKO_005 476 CDS 100% 10.800 15.120 N Mzf1 n/a
3 TRCN0000374345 CACGGCAGAGCCAGATATGAT pLKO_005 1125 CDS 100% 5.625 7.875 N Mzf1 n/a
4 TRCN0000086370 CCTTGGTTGACAGACTTCGAT pLKO.1 677 CDS 100% 3.000 2.400 N Mzf1 n/a
5 TRCN0000374344 CTGCTTTCTTGTGGGATATAC pLKO_005 2759 3UTR 100% 13.200 9.240 N Mzf1 n/a
6 TRCN0000321553 GACGATGAGAGAGAAGATATA pLKO_005 409 CDS 100% 13.200 9.240 N Mzf1 n/a
7 TRCN0000374285 CTAGCCTCTCTGGACAGATAC pLKO_005 1184 CDS 100% 10.800 7.560 N Mzf1 n/a
8 TRCN0000321552 GCTACGCCCAGAAGTACATTC pLKO_005 543 CDS 100% 10.800 7.560 N Mzf1 n/a
9 TRCN0000086368 CCACTGAACCTACCAATGAAA pLKO.1 859 CDS 100% 5.625 3.938 N Mzf1 n/a
10 TRCN0000086371 CTTCCGGTATGAGGATGCAAT pLKO.1 474 CDS 100% 4.950 3.465 N Mzf1 n/a
11 TRCN0000086372 CGCGCCACCAAAGGACCCATA pLKO.1 2165 CDS 100% 0.000 0.000 N Mzf1 n/a
12 TRCN0000329828 ACCAGAGCACCAAGCTCATTC pLKO_005 2483 CDS 100% 10.800 7.560 N MZF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15623 pDONR223 0% 31.8% 25.6% None (many diffs) n/a
2 ccsbBroad304_15623 pLX_304 0% 31.8% 25.6% V5 (many diffs) n/a
Download CSV