Transcript: Mouse NM_145820.3

Mus musculus ventricular zone expressed PH domain-containing 1 (Veph1), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Veph1 (72789)
Length:
6450
CDS:
383..2884

Additional Resources:

NCBI RefSeq record:
NM_145820.3
NBCI Gene record:
Veph1 (72789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248510 AGCCGAGAAGTAACCACATAT pLKO_005 2858 CDS 100% 13.200 18.480 N Veph1 n/a
2 TRCN0000248509 TGCGGTTCTTCGACGTGTTTG pLKO_005 2427 CDS 100% 10.800 15.120 N Veph1 n/a
3 TRCN0000248513 GATTCGCACACCCGCTCTTAT pLKO_005 2886 3UTR 100% 13.200 9.240 N Veph1 n/a
4 TRCN0000248512 GAAATCTTCACAGATAGTAAG pLKO_005 2747 CDS 100% 10.800 7.560 N Veph1 n/a
5 TRCN0000248511 GCAAGGTACAGAGCGTGAAAG pLKO_005 2682 CDS 100% 10.800 7.560 N Veph1 n/a
6 TRCN0000200733 GCTATGTGATTTATGACTGTA pLKO.1 3165 3UTR 100% 4.950 3.465 N Veph1 n/a
7 TRCN0000190521 GAAGTTCATCAAGAGGTGGAA pLKO.1 2572 CDS 100% 2.640 1.848 N Veph1 n/a
8 TRCN0000189956 GCCAGTGTCAACAAAGAGGAA pLKO.1 2927 3UTR 100% 2.640 1.848 N Veph1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145820.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04106 pDONR223 100% 85.3% 85.4% None (many diffs) n/a
2 ccsbBroad304_04106 pLX_304 0% 85.3% 85.4% V5 (many diffs) n/a
3 TRCN0000472697 CAATACCTGCAAAGTACAACAGAT pLX_317 16.6% 85.3% 85.4% V5 (many diffs) n/a
Download CSV