Transcript: Human NM_145872.2

Homo sapiens ankyrin repeat and SOCS box containing 4 (ASB4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
ASB4 (51666)
Length:
1565
CDS:
72..1121

Additional Resources:

NCBI RefSeq record:
NM_145872.2
NBCI Gene record:
ASB4 (51666)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118389 CCCGAGATGACGACTTTAAAT pLKO.1 811 CDS 100% 15.000 21.000 N ASB4 n/a
2 TRCN0000118387 GCCAAGTTAGTTAAGAGAAAT pLKO.1 111 CDS 100% 13.200 9.240 N ASB4 n/a
3 TRCN0000118391 CCTCCATCTCTCTGTCTTGTT pLKO.1 305 CDS 100% 4.950 3.465 N ASB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03361 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03361 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468196 TGGTTGACACCCCCACGCTGCTTC pLX_317 22% 100% 100% V5 n/a
Download CSV