Transcript: Mouse NM_145944.4

Mus musculus coiled-coil domain containing 25 (Ccdc25), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Ccdc25 (67179)
Length:
2228
CDS:
157..783

Additional Resources:

NCBI RefSeq record:
NM_145944.4
NBCI Gene record:
Ccdc25 (67179)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145944.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247091 GCCCATGTGTACCTACGATTA pLKO_005 298 CDS 100% 10.800 15.120 N Ccdc25 n/a
2 TRCN0000247094 TGCAAGATGAACAACGTTAAT pLKO_005 403 CDS 100% 13.200 10.560 N Ccdc25 n/a
3 TRCN0000247093 TACATGGGAAAGGATAAATAT pLKO_005 208 CDS 100% 15.000 10.500 N Ccdc25 n/a
4 TRCN0000247095 CTGGCATGCAAATCCATATTC pLKO_005 1851 3UTR 100% 13.200 9.240 N Ccdc25 n/a
5 TRCN0000247092 ATGAAATCTTGAACCGATTAG pLKO_005 536 CDS 100% 10.800 7.560 N Ccdc25 n/a
6 TRCN0000143877 CATTCAAGGCTGCAAGATGAA pLKO.1 393 CDS 100% 4.950 3.465 N CCDC25 n/a
7 TRCN0000122667 GCTGCAAGATGAACAACGTTA pLKO.1 401 CDS 100% 4.950 3.465 N CCDC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145944.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08496 pDONR223 100% 91.8% 94.7% None (many diffs) n/a
2 ccsbBroad304_08496 pLX_304 0% 91.8% 94.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000480827 CGCTCATGACCGGATGACATGGGC pLX_317 63.1% 91.8% 94.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV