Transcript: Mouse NM_146043.4

Mus musculus spindlin 1 (Spin1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Spin1 (20729)
Length:
4455
CDS:
261..1049

Additional Resources:

NCBI RefSeq record:
NM_146043.4
NBCI Gene record:
Spin1 (20729)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146043.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072090 GCGGACACAATGATCGGCAAA pLKO.1 645 CDS 100% 4.050 5.670 N Spin1 n/a
2 TRCN0000334399 GCGGACACAATGATCGGCAAA pLKO_005 645 CDS 100% 4.050 5.670 N Spin1 n/a
3 TRCN0000072088 CGATTTCCATATTTACGTCTA pLKO.1 1007 CDS 100% 4.050 3.240 N Spin1 n/a
4 TRCN0000334320 CGATTTCCATATTTACGTCTA pLKO_005 1007 CDS 100% 4.050 3.240 N Spin1 n/a
5 TRCN0000072091 GATGGATTTGACTGTGTTTAT pLKO.1 534 CDS 100% 13.200 9.240 N Spin1 n/a
6 TRCN0000334319 GATGGATTTGACTGTGTTTAT pLKO_005 534 CDS 100% 13.200 9.240 N Spin1 n/a
7 TRCN0000072092 CCATATTTACGTCTACGATTT pLKO.1 1013 CDS 100% 10.800 7.560 N Spin1 n/a
8 TRCN0000141981 GCCACAATGCAAGCATAGTTT pLKO.1 1403 3UTR 100% 5.625 3.938 N SPIN1 n/a
9 TRCN0000072089 CCTGTGAATCCTTCCCTGTAT pLKO.1 501 CDS 100% 4.950 3.465 N Spin1 n/a
10 TRCN0000334318 CCTGTGAATCCTTCCCTGTAT pLKO_005 501 CDS 100% 4.950 3.465 N Spin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146043.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02564 pDONR223 100% 93% 99.2% None (many diffs) n/a
2 ccsbBroad304_02564 pLX_304 0% 93% 99.2% V5 (many diffs) n/a
3 TRCN0000469572 ACTTATCTTTTAGTTCCCTCCACA pLX_317 53.2% 93% 99.2% V5 (many diffs) n/a
Download CSV