Transcript: Mouse NM_146047.2

Mus musculus CLPTM1-like (Clptm1l), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Clptm1l (218335)
Length:
2378
CDS:
237..1856

Additional Resources:

NCBI RefSeq record:
NM_146047.2
NBCI Gene record:
Clptm1l (218335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250068 CACTCCTAAATATCAAGTATA pLKO_005 1495 CDS 100% 13.200 18.480 N Clptm1l n/a
2 TRCN0000250070 TTTCGTAGACACCAACTTATA pLKO_005 1073 CDS 100% 13.200 18.480 N Clptm1l n/a
3 TRCN0000250069 GGGACGCTGTATGCATATATT pLKO_005 540 CDS 100% 15.000 12.000 N Clptm1l n/a
4 TRCN0000175492 CGTGTTTCAGAAGGAACCATA pLKO.1 2013 3UTR 100% 4.950 3.960 N Clptm1l n/a
5 TRCN0000217197 CAAACTGCAGCTGAGTGTTTA pLKO.1 389 CDS 100% 13.200 9.240 N Clptm1l n/a
6 TRCN0000250067 CACCCTCTCTTCTCGTGTTTC pLKO_005 2000 3UTR 100% 10.800 7.560 N Clptm1l n/a
7 TRCN0000173671 CTGGCCTGTTTCAGAGATGAT pLKO.1 1719 CDS 100% 4.950 3.465 N Clptm1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.