Transcript: Mouse NM_146052.4

Mus musculus leucine rich repeat containing 3B (Lrrc3b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lrrc3b (218763)
Length:
1676
CDS:
573..1352

Additional Resources:

NCBI RefSeq record:
NM_146052.4
NBCI Gene record:
Lrrc3b (218763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146052.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247540 TATGCCATGCTCGTCACTATG pLKO_005 1182 CDS 100% 10.800 15.120 N Lrrc3b n/a
2 TRCN0000247542 TCTTCCTCTGGAGGGTTAAAT pLKO_005 693 CDS 100% 15.000 10.500 N Lrrc3b n/a
3 TRCN0000247539 TGCCCGGAGACACCTTGAATA pLKO_005 1265 CDS 100% 13.200 9.240 N Lrrc3b n/a
4 TRCN0000160914 GTCACCTGTAGCAATGCAAAT pLKO.1 714 CDS 100% 10.800 7.560 N LRRC3B n/a
5 TRCN0000247541 GTCTGACAACAGGATTCAAAG pLKO_005 932 CDS 100% 10.800 7.560 N Lrrc3b n/a
6 TRCN0000247543 CTTTACACAAACAACACTAAT pLKO_005 1480 3UTR 100% 13.200 7.920 N Lrrc3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146052.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04694 pDONR223 100% 90.3% 99.6% None (many diffs) n/a
2 ccsbBroad304_04694 pLX_304 0% 90.3% 99.6% V5 (many diffs) n/a
3 TRCN0000472627 CGCACGTTAAAGCATAACTCTCAC pLX_317 58.5% 90.3% 99.6% V5 (many diffs) n/a
Download CSV