Transcript: Mouse NM_146094.2

Mus musculus fatty acid desaturase 1 (Fads1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fads1 (76267)
Length:
3474
CDS:
165..1508

Additional Resources:

NCBI RefSeq record:
NM_146094.2
NBCI Gene record:
Fads1 (76267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114349 CGGCATCAAGTATGAGTCCAA pLKO.1 1403 CDS 100% 2.640 3.696 N Fads1 n/a
2 TRCN0000320187 CGGCATCAAGTATGAGTCCAA pLKO_005 1403 CDS 100% 2.640 3.696 N Fads1 n/a
3 TRCN0000114348 CCTCTATACTTCCAGTGGTAT pLKO.1 999 CDS 100% 4.950 3.960 N Fads1 n/a
4 TRCN0000320186 CCTCTATACTTCCAGTGGTAT pLKO_005 999 CDS 100% 4.950 3.960 N Fads1 n/a
5 TRCN0000114347 GCCTCTATACTTCCAGTGGTA pLKO.1 998 CDS 100% 2.640 2.112 N Fads1 n/a
6 TRCN0000114346 GCCACTATGAATCTAATGTTT pLKO.1 1577 3UTR 100% 5.625 3.938 N Fads1 n/a
7 TRCN0000320188 GCCACTATGAATCTAATGTTT pLKO_005 1577 3UTR 100% 5.625 3.938 N Fads1 n/a
8 TRCN0000114350 CCCTTTGGATCTTTGGAACTT pLKO.1 619 CDS 100% 4.950 3.465 N Fads1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10948 pDONR223 100% 85.1% 86.8% None (many diffs) n/a
2 ccsbBroad304_10948 pLX_304 0% 85.1% 86.8% V5 (many diffs) n/a
3 TRCN0000468135 AATTATATACCGAAGTCCCTCCCG pLX_317 28.1% 85.1% 86.8% V5 (many diffs) n/a
Download CSV