Transcript: Mouse NM_146095.4

Mus musculus RAR-related orphan receptor beta (Rorb), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rorb (225998)
Length:
8755
CDS:
72..1484

Additional Resources:

NCBI RefSeq record:
NM_146095.4
NBCI Gene record:
Rorb (225998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146095.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222415 GAAGGTTATTACAGCATAGAT pLKO.1 561 CDS 100% 5.625 7.875 N Rorb n/a
2 TRCN0000222411 CGGGATAACAATGTCTGAGAT pLKO.1 719 CDS 100% 4.950 6.930 N Rorb n/a
3 TRCN0000222412 GCATTTGACTTTGCGAAGAAT pLKO.1 1128 CDS 100% 5.625 4.500 N Rorb n/a
4 TRCN0000022173 GCAAAGTTAATAGCCAAGATA pLKO.1 1323 CDS 100% 5.625 3.938 N RORB n/a
5 TRCN0000222413 CCATTGTACAAGGAGCTCTTT pLKO.1 1434 CDS 100% 4.950 3.465 N Rorb n/a
6 TRCN0000022172 CCCAAGGCAGAGAAACTGTTT pLKO.1 242 CDS 100% 4.950 3.465 N RORB n/a
7 TRCN0000222414 GCTGTGTCAGAACGATCAGAT pLKO.1 959 CDS 100% 4.950 3.465 N Rorb n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3030 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000178741 CACACACATACACACACACAA pLKO.1 3020 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146095.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491512 CGTTTACCCCCCGCCGCCCACGTC pLX_317 20.7% 90.7% 95.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488384 TATAAGGCACCCAATAACCGAGAT pLX_317 13.6% 90.6% 95.3% V5 (many diffs) n/a
Download CSV