Transcript: Mouse NM_146108.2

Mus musculus 3-hydroxyisobutyryl-Coenzyme A hydrolase (Hibch), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hibch (227095)
Length:
1838
CDS:
73..1230

Additional Resources:

NCBI RefSeq record:
NM_146108.2
NBCI Gene record:
Hibch (227095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229744 TGATGTGGGTGGAGGTTATTT pLKO_005 597 CDS 100% 15.000 21.000 N HIBCH n/a
2 TRCN0000251113 TGATGTGGGTGGAGGTTATTT pLKO_005 597 CDS 100% 15.000 21.000 N Hibch n/a
3 TRCN0000217651 GAAACGGGAATAGGACTATTT pLKO.1 574 CDS 100% 13.200 18.480 N Hibch n/a
4 TRCN0000251112 GAAACGGGAATAGGACTATTT pLKO_005 574 CDS 100% 13.200 18.480 N Hibch n/a
5 TRCN0000265314 ATATGATCCGGCAGATCTATC pLKO_005 257 CDS 100% 10.800 15.120 N Hibch n/a
6 TRCN0000251114 CACCTCAAGGGTCTAAGTTTC pLKO_005 1521 3UTR 100% 10.800 15.120 N Hibch n/a
7 TRCN0000251111 TGATCATGGAATATCGGATAA pLKO_005 1046 CDS 100% 10.800 15.120 N Hibch n/a
8 TRCN0000180028 CAACGCACTGAGTCTGAATAT pLKO.1 240 CDS 100% 13.200 9.240 N Hibch n/a
9 TRCN0000215546 GATCATGGAATATCGGATAAC pLKO.1 1047 CDS 100% 10.800 7.560 N Hibch n/a
10 TRCN0000180890 GCAGGTGTCTTAGAAAGCTAT pLKO.1 790 CDS 100% 4.950 3.465 N Hibch n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.