Transcript: Mouse NM_146122.3

Mus musculus DENN/MADD domain containing 1A (Dennd1a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dennd1a (227801)
Length:
4352
CDS:
256..3306

Additional Resources:

NCBI RefSeq record:
NM_146122.3
NBCI Gene record:
Dennd1a (227801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143883 CCAGGAAGTTCTACAGACTTT pLKO.1 384 CDS 100% 4.950 6.930 N DENND1A n/a
2 TRCN0000338560 CCAGGAAGTTCTACAGACTTT pLKO_005 384 CDS 100% 4.950 6.930 N DENND1A n/a
3 TRCN0000249256 TGAAGCTTGCTCATCCATATA pLKO_005 2141 CDS 100% 13.200 10.560 N Dennd1a n/a
4 TRCN0000141749 GCAAACAGAGATTCGGGTTCT pLKO.1 494 CDS 100% 4.050 3.240 N DENND1A n/a
5 TRCN0000249255 ACACCAGCAACTCTAACTTAT pLKO_005 3844 3UTR 100% 13.200 9.240 N Dennd1a n/a
6 TRCN0000249254 AGACTACATTTGAAGTGTATG pLKO_005 284 CDS 100% 10.800 7.560 N Dennd1a n/a
7 TRCN0000249257 ATTCGGGTTCTGCCGCTTATC pLKO_005 504 CDS 100% 10.800 7.560 N Dennd1a n/a
8 TRCN0000350941 ATTCGGGTTCTGCCGCTTATC pLKO_005 504 CDS 100% 10.800 7.560 N DENND1A n/a
9 TRCN0000192295 CGATGTCTTTGAGGAGGAAAT pLKO.1 1401 CDS 100% 10.800 7.560 N Dennd1a n/a
10 TRCN0000201104 CCAGCATACCTGAGAATAGAA pLKO.1 746 CDS 100% 5.625 3.938 N Dennd1a n/a
11 TRCN0000141990 GACTACAGTGACCAGGAAGTT pLKO.1 373 CDS 100% 4.950 3.465 N DENND1A n/a
12 TRCN0000249253 TACCTCATAGGAATCCATTTA pLKO_005 988 CDS 100% 0.000 0.000 N Dennd1a n/a
13 TRCN0000338586 TACCTCATAGGAATCCATTTA pLKO_005 988 CDS 100% 0.000 0.000 N DENND1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03844 pDONR223 100% 48.5% 49.6% None (many diffs) n/a
2 ccsbBroad304_03844 pLX_304 0% 48.5% 49.6% V5 (many diffs) n/a
3 TRCN0000481037 TATGGCCGATTTACATGACTCTCC pLX_317 25.9% 48.5% 49.6% V5 (many diffs) n/a
Download CSV