Transcript: Mouse NM_146125.2

Mus musculus inositol 1,4,5-trisphosphate 3-kinase A (Itpka), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Itpka (228550)
Length:
1808
CDS:
43..1422

Additional Resources:

NCBI RefSeq record:
NM_146125.2
NBCI Gene record:
Itpka (228550)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025557 GAGTCCTTTCAGAAAGCGCTA pLKO.1 573 CDS 100% 2.160 3.024 N Itpka n/a
2 TRCN0000025558 CGCTACATGCAATGGCGCGAA pLKO.1 976 CDS 100% 0.720 1.008 N Itpka n/a
3 TRCN0000362101 AGAGCTGAATGACACTAATTT pLKO_005 1618 3UTR 100% 15.000 10.500 N Itpka n/a
4 TRCN0000362100 GCTGCGGAAGGACATGTATAA pLKO_005 885 CDS 100% 13.200 9.240 N Itpka n/a
5 TRCN0000025555 CCGTGTCTTTGAGGAGTTCAT pLKO.1 1104 CDS 100% 4.950 3.465 N Itpka n/a
6 TRCN0000025554 GCATCAAGAAAGCCGATGGAT pLKO.1 1037 CDS 100% 3.000 2.100 N Itpka n/a
7 TRCN0000025556 GCTGGACAATCTCATTGGCAT pLKO.1 1377 CDS 100% 2.640 1.848 N Itpka n/a
8 TRCN0000362179 CAACCGTGAGGACGGCTATTT pLKO_005 1350 CDS 100% 13.200 7.920 N Itpka n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488971 AATTTTGGCCGCCAAAAATCGGTC pLX_317 26.1% 87.6% 93.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV