Transcript: Mouse NM_146171.1

Mus musculus non-SMC condensin I complex, subunit D2 (Ncapd2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ncapd2 (68298)
Length:
4527
CDS:
109..4287

Additional Resources:

NCBI RefSeq record:
NM_146171.1
NBCI Gene record:
Ncapd2 (68298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146171.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244478 GCCTGAGGGCAAGGCTATAAT pLKO_005 3903 CDS 100% 15.000 12.000 N NCAPD2 n/a
2 TRCN0000110227 GCCAGCTTTCTAGCCAATAAT pLKO.1 1393 CDS 100% 15.000 10.500 N Ncapd2 n/a
3 TRCN0000110229 GCAAGTTACAAACAGGCTATT pLKO.1 1681 CDS 100% 10.800 7.560 N Ncapd2 n/a
4 TRCN0000110228 CCTTTGTTCCACTGCTACTTA pLKO.1 3116 CDS 100% 5.625 3.938 N Ncapd2 n/a
5 TRCN0000110226 GCAAGGCTATAATAGATGAAT pLKO.1 3911 CDS 100% 5.625 3.938 N Ncapd2 n/a
6 TRCN0000110225 CAGGGTATCTTACTGGATGAT pLKO.1 4321 3UTR 100% 4.950 3.465 N Ncapd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146171.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.