Transcript: Mouse NM_146173.3

Mus musculus tetraspanin 33 (Tspan33), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tspan33 (232670)
Length:
2018
CDS:
230..1081

Additional Resources:

NCBI RefSeq record:
NM_146173.3
NBCI Gene record:
Tspan33 (232670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146173.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094710 GTGAGCGAGATCATCAACAAT pLKO.1 605 CDS 100% 5.625 7.875 N Tspan33 n/a
2 TRCN0000094713 TCAACAATGCTATCGTGCATT pLKO.1 618 CDS 100% 0.495 0.693 N Tspan33 n/a
3 TRCN0000094712 GTCTCAGAATATGTACTTCAA pLKO.1 724 CDS 100% 4.950 3.960 N Tspan33 n/a
4 TRCN0000094711 CTGGTCTCAGAATATGTACTT pLKO.1 721 CDS 100% 4.950 3.465 N Tspan33 n/a
5 TRCN0000094709 CGAGGTTTATTTCATGCTGTT pLKO.1 1286 3UTR 100% 4.050 2.835 N Tspan33 n/a
6 TRCN0000152435 CCTGCTCTTCTTCTTCAACAT pLKO.1 301 CDS 100% 4.950 2.970 N TSPAN33 n/a
7 TRCN0000152777 GCTCTTCTTCTTCAACATGCT pLKO.1 304 CDS 100% 2.640 1.584 N TSPAN33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146173.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05472 pDONR223 100% 90.6% 96.8% None (many diffs) n/a
2 ccsbBroad304_05472 pLX_304 0% 90.6% 96.8% V5 (many diffs) n/a
3 TRCN0000471295 CGAGTGACGGCATGAGGGGAGATG pLX_317 50.4% 90.6% 96.8% V5 (many diffs) n/a
Download CSV