Transcript: Mouse NM_146200.1

Mus musculus eukaryotic translation initiation factor 3, subunit C (Eif3c), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Eif3c (56347)
Length:
2896
CDS:
60..2795

Additional Resources:

NCBI RefSeq record:
NM_146200.1
NBCI Gene record:
Eif3c (56347)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305268 ACGAGGACGGAGTCGGTAATA pLKO_005 619 CDS 100% 13.200 18.480 N Eif3c n/a
2 TRCN0000305269 CCCGATTCTACATCCGAATAC pLKO_005 367 CDS 100% 10.800 15.120 N Eif3c n/a
3 TRCN0000096840 CCTCATACGAACCATCCGTAA pLKO.1 245 CDS 100% 4.050 5.670 N Eif3c n/a
4 TRCN0000309077 CCTCATACGAACCATCCGTAA pLKO_005 245 CDS 100% 4.050 5.670 N Eif3c n/a
5 TRCN0000096841 CCTTTGTTACTGAGCGAGGAT pLKO.1 162 CDS 100% 2.640 3.696 N Eif3c n/a
6 TRCN0000096839 GCATCAATGAACTGATGGATA pLKO.1 1264 CDS 100% 0.495 0.693 N Eif3c n/a
7 TRCN0000305211 TGCGCCAGAAGATCCGGAAAT pLKO_005 481 CDS 100% 10.800 7.560 N Eif3c n/a
8 TRCN0000096843 CCTGACAAAGGATGCACACAA pLKO.1 1925 CDS 100% 4.950 3.465 N Eif3c n/a
9 TRCN0000096842 GTACTACAAGTTTGACTACAA pLKO.1 1583 CDS 100% 4.950 2.970 N Eif3c n/a
10 TRCN0000309140 GTACTACAAGTTTGACTACAA pLKO_005 1583 CDS 100% 4.950 2.970 N Eif3c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01982 pDONR223 100% 89% 96.7% None (many diffs) n/a
2 ccsbBroad304_01982 pLX_304 0% 89% 96.7% V5 (many diffs) n/a
3 TRCN0000478431 GTAAGTACACCCCTAATCTCTATT pLX_317 11.5% 89% 96.7% V5 (many diffs) n/a
Download CSV