Transcript: Mouse NM_146229.2

Mus musculus dynein cytoplasmic 1 light intermediate chain 1 (Dync1li1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Dync1li1 (235661)
Length:
2046
CDS:
52..1623

Additional Resources:

NCBI RefSeq record:
NM_146229.2
NBCI Gene record:
Dync1li1 (235661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380514 AGTATGGCGCAGCGCTGATTT pLKO_005 881 CDS 100% 13.200 18.480 N Dync1li1 n/a
2 TRCN0000090510 GCAGAAGTTGATTAGAGACTT pLKO.1 612 CDS 100% 4.950 6.930 N Dync1li1 n/a
3 TRCN0000090509 CCTGTCAGAAAGTTCGTGCAT pLKO.1 1120 CDS 100% 2.640 3.696 N Dync1li1 n/a
4 TRCN0000090511 GCTAGACAGAATCACACGGAA pLKO.1 1545 CDS 100% 2.640 2.112 N Dync1li1 n/a
5 TRCN0000090512 GCTGATTTACACTTCAGTAAA pLKO.1 894 CDS 100% 1.320 1.056 N Dync1li1 n/a
6 TRCN0000379534 GGTCATGTTGGTTGTTGATAT pLKO_005 486 CDS 100% 13.200 9.240 N Dync1li1 n/a
7 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 1896 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03227 pDONR223 100% 86.9% 94.4% None (many diffs) n/a
2 ccsbBroad304_03227 pLX_304 0% 86.9% 94.4% V5 (many diffs) n/a
3 TRCN0000477080 GGCTCATTTAAAATACTGGTCCAG pLX_317 26.5% 86.9% 94.4% V5 (many diffs) n/a
Download CSV