Transcript: Mouse NM_146255.2

Mus musculus solute carrier family 1 (glutamate transporter), member 7 (Slc1a7), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc1a7 (242607)
Length:
3005
CDS:
213..1922

Additional Resources:

NCBI RefSeq record:
NM_146255.2
NBCI Gene record:
Slc1a7 (242607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079851 CGCTTCCGAACCATGATTAAT pLKO.1 1605 CDS 100% 15.000 21.000 N Slc1a7 n/a
2 TRCN0000079849 GCTAGACTTTGGACAGATCAT pLKO.1 1436 CDS 100% 4.950 6.930 N Slc1a7 n/a
3 TRCN0000079852 GCCTCTCACCACAGGAGATTA pLKO.1 364 CDS 100% 13.200 9.240 N Slc1a7 n/a
4 TRCN0000416436 GCTCACGTGTGCAGAACTTTG pLKO_005 814 CDS 100% 10.800 7.560 N Slc1a7 n/a
5 TRCN0000437604 TGGTAGAAGCCACGTTCAAAC pLKO_005 694 CDS 100% 10.800 7.560 N Slc1a7 n/a
6 TRCN0000079848 CCACAGCATGTGTGTTGGTTT pLKO.1 2443 3UTR 100% 4.950 3.465 N Slc1a7 n/a
7 TRCN0000079850 GTGCCTTAATGAGTCTGTCAT pLKO.1 992 CDS 100% 4.950 3.465 N Slc1a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06958 pDONR223 100% 85.7% 90.5% None (many diffs) n/a
2 ccsbBroad304_06958 pLX_304 0% 85.7% 90.5% V5 (many diffs) n/a
3 TRCN0000472841 CTACTTATCCTGAACTACCACGTC pLX_317 29.8% 85.7% 90.5% V5 (many diffs) n/a
Download CSV