Transcript: Mouse NM_146330.1

Mus musculus olfactory receptor 958 (Olfr958), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Olfr958 (258327)
Length:
939
CDS:
1..939

Additional Resources:

NCBI RefSeq record:
NM_146330.1
NBCI Gene record:
Olfr958 (258327)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186661 GTCCGTATTTGATATGGGTTT pLKO.1 198 CDS 100% 4.050 5.670 N Olfr958 n/a
2 TRCN0000187637 GTGTTATTCCTGCCCTTCTAT pLKO.1 85 CDS 100% 5.625 3.938 N Olfr958 n/a
3 TRCN0000188239 CTTGGGAGCATTGAGTGCTTT pLKO.1 319 CDS 100% 4.950 3.465 N Olfr958 n/a
4 TRCN0000204060 GCACATGGCTATTAGGATGTT pLKO.1 440 CDS 100% 4.950 3.465 N Olfr958 n/a
5 TRCN0000359972 ACCACTTCTTCTGTGACATTT pLKO_005 524 CDS 100% 13.200 6.600 Y OR6B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488547 ACCAACCCAAGCTACGGATAATGC pLX_317 38.1% 83.7% 88.8% V5 (many diffs) n/a
Download CSV