Transcript: Mouse NM_147033.2

Mus musculus olfactory receptor 714 (Olfr714), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr714 (259035)
Length:
954
CDS:
1..954

Additional Resources:

NCBI RefSeq record:
NM_147033.2
NBCI Gene record:
Olfr714 (259035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204464 CTTCATGGAGATCGGCTTCAA pLKO.1 204 CDS 100% 4.950 3.960 N Olfr714 n/a
2 TRCN0000204540 CGGTTTGAGGTCTATGCCATT pLKO.1 583 CDS 100% 4.050 2.835 N Olfr714 n/a
3 TRCN0000060370 GCTGTGCCACTCAGATGTATT pLKO.1 290 CDS 100% 13.200 6.600 Y OR10A2 n/a
4 TRCN0000189152 GCTGTGCCACTCAGATGTATT pLKO.1 290 CDS 100% 13.200 6.600 Y Olfr714 n/a
5 TRCN0000188956 GCAGCTTCCATCCTCAAGATT pLKO.1 667 CDS 100% 5.625 2.813 Y Olfr714 n/a
6 TRCN0000204604 CAGTCCCTTGCATTACCCAAT pLKO.1 384 CDS 100% 4.050 2.025 Y Olfr714 n/a
7 TRCN0000186239 CTTTCTCAGGAACTTATCCTT pLKO.1 186 CDS 100% 3.000 1.500 Y Olfr714 n/a
8 TRCN0000189188 CTTCCTGGCATTTCTCACCAT pLKO.1 84 CDS 100% 2.640 1.320 Y Olfr714 n/a
9 TRCN0000184920 CCATGTATTTCTTTCTCAGTA pLKO.1 176 CDS 100% 4.950 2.475 Y OR5AP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10030 pDONR223 100% 83.9% 85.1% None (many diffs) n/a
2 ccsbBroad304_10030 pLX_304 0% 83.9% 85.1% V5 (many diffs) n/a
3 TRCN0000491481 TAGCCTAACGACCATTAGCCTCAA pLX_317 24.1% 83.9% 85.1% V5 (many diffs) n/a
Download CSV