Transcript: Mouse NM_147064.1

Mus musculus olfactory receptor 449 (Olfr449), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr449 (259067)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_147064.1
NBCI Gene record:
Olfr449 (259067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187710 GTGATATCTCTCCCGTTCTTA pLKO.1 536 CDS 100% 5.625 7.875 N Olfr449 n/a
2 TRCN0000203678 CTTATGTGTACGGAATGCGTT pLKO.1 319 CDS 100% 2.640 3.696 N Olfr449 n/a
3 TRCN0000188398 CGTGGTGGTTACCATCTTCTA pLKO.1 729 CDS 100% 4.950 3.465 N Olfr449 n/a
4 TRCN0000185721 GATACAGCTTTACTTCTTCAT pLKO.1 294 CDS 100% 4.950 3.465 N Olfr449 n/a
5 TRCN0000188850 GCTCTGGTCATCTTCCTCTTT pLKO.1 607 CDS 100% 4.950 3.465 N Olfr449 n/a
6 TRCN0000188219 CCAACCTGTCTTTCTTGGAGA pLKO.1 191 CDS 100% 2.640 1.584 N Olfr449 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04902 pDONR223 100% 86.2% 92.6% None (many diffs) n/a
2 ccsbBroad304_04902 pLX_304 0% 86.2% 92.6% V5 (many diffs) n/a
3 TRCN0000480908 CCACGTCTGATCGATGGACCGGAC pLX_317 44.3% 86.2% 92.6% V5 (many diffs) n/a
Download CSV