Transcript: Human NM_147181.3

Homo sapiens potassium voltage-gated channel interacting protein 4 (KCNIP4), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
KCNIP4 (80333)
Length:
2259
CDS:
121..771

Additional Resources:

NCBI RefSeq record:
NM_147181.3
NBCI Gene record:
KCNIP4 (80333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_147181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418416 AGCTTGACACTGAAGCATATT pLKO_005 862 3UTR 100% 13.200 10.560 N KCNIP4 n/a
2 TRCN0000044541 CCAGACAACACGTTGAAACAT pLKO.1 632 CDS 100% 5.625 4.500 N KCNIP4 n/a
3 TRCN0000415454 GTGATTTAACTTGTCAAATAG pLKO_005 763 CDS 100% 13.200 9.240 N KCNIP4 n/a
4 TRCN0000423909 GCTGTGAGTTTCGAGGATTTC pLKO_005 433 CDS 100% 10.800 7.560 N KCNIP4 n/a
5 TRCN0000044542 CCCAGTGGTGTTGTTAATGAA pLKO.1 313 CDS 100% 5.625 3.938 N KCNIP4 n/a
6 TRCN0000044539 GTTACCATAGATGAGTTCATT pLKO.1 688 CDS 100% 5.625 3.938 N KCNIP4 n/a
7 TRCN0000044540 GATCCTTTACAGAGGATTTAA pLKO.1 282 CDS 100% 1.500 1.050 N KCNIP4 n/a
8 TRCN0000069731 GAGGATTTCATCAAAGGTCTT pLKO.1 445 CDS 100% 4.050 2.430 N Kcnip4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09030 pDONR223 100% 86% 86% None (many diffs) n/a
2 ccsbBroad304_09030 pLX_304 0% 86% 86% V5 (many diffs) n/a
3 TRCN0000474912 GATGACTATTTTGACTTTCTTTCT pLX_317 24.1% 86% 86% V5 (many diffs) n/a
Download CSV