Transcript: Mouse NM_148931.3

Mus musculus solute carrier family 6 (neurotransmitter transporter, glycine), member 5 (Slc6a5), transcript variant b, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc6a5 (104245)
Length:
2467
CDS:
23..2398

Additional Resources:

NCBI RefSeq record:
NM_148931.3
NBCI Gene record:
Slc6a5 (104245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070364 CCCGATTATGTTCGTGATAAA pLKO.1 2191 CDS 100% 13.200 18.480 N Slc6a5 n/a
2 TRCN0000043530 CGCAAAGTCAACATTGAGAAT pLKO.1 1595 CDS 100% 4.950 3.960 N SLC6A5 n/a
3 TRCN0000070366 CACACCAGAATGCAAAGATAA pLKO.1 952 CDS 100% 13.200 9.240 N Slc6a5 n/a
4 TRCN0000070367 CCTTGTCATCATTGCCATATT pLKO.1 1924 CDS 100% 13.200 9.240 N Slc6a5 n/a
5 TRCN0000070365 GCAGAGATTCTGTGAAGACAT pLKO.1 1978 CDS 100% 4.950 3.465 N Slc6a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07366 pDONR223 100% 87.5% 93% None (many diffs) n/a
2 ccsbBroad304_07366 pLX_304 0% 87.5% 93% V5 (many diffs) n/a
3 TRCN0000471680 GGCCAAACTTTGCAATACTTCTTT pLX_317 11.6% 87.5% 93% V5 (many diffs) n/a
Download CSV