Transcript: Human NM_152284.4

Homo sapiens charged multivesicular body protein 4C (CHMP4C), mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
CHMP4C (92421)
Length:
1852
CDS:
180..881

Additional Resources:

NCBI RefSeq record:
NM_152284.4
NBCI Gene record:
CHMP4C (92421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152284.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179242 GACAAATATCCGCCTTCCAAA pLKO.1 719 CDS 100% 4.950 6.930 N CHMP4C n/a
2 TRCN0000292315 GACAAATATCCGCCTTCCAAA pLKO_005 719 CDS 100% 4.950 6.930 N CHMP4C n/a
3 TRCN0000179569 GATGGCACACTTTCTACCATT pLKO.1 426 CDS 100% 4.950 6.930 N CHMP4C n/a
4 TRCN0000180929 GCAGAATAAGCGAGCTGCATT pLKO.1 356 CDS 100% 4.950 6.930 N CHMP4C n/a
5 TRCN0000343897 GCAGAATAAGCGAGCTGCATT pLKO_005 356 CDS 100% 4.950 6.930 N CHMP4C n/a
6 TRCN0000146312 CCAAGAAATCTCAGAAGCATT pLKO.1 605 CDS 100% 4.950 3.465 N CHMP4C n/a
7 TRCN0000297971 CCAAGAAATCTCAGAAGCATT pLKO_005 605 CDS 100% 4.950 3.465 N CHMP4C n/a
8 TRCN0000147799 GCGATGAAATCTGTTCATGAA pLKO.1 522 CDS 100% 0.495 0.347 N CHMP4C n/a
9 TRCN0000292316 GCGATGAAATCTGTTCATGAA pLKO_005 522 CDS 100% 0.495 0.347 N CHMP4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152284.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04581 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04581 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466151 GATGTAGCGCAATTCGGCTTTTCA pLX_317 61.6% 100% 100% V5 n/a
Download CSV