Transcript: Human NM_152290.4

Homo sapiens chromosome 1 open reading frame 158 (C1orf158), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C1orf158 (93190)
Length:
3564
CDS:
232..816

Additional Resources:

NCBI RefSeq record:
NM_152290.4
NBCI Gene record:
C1orf158 (93190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131105 GACAACAAGTGGCGCAGATAA pLKO.1 883 3UTR 100% 13.200 18.480 N C1orf158 n/a
2 TRCN0000422871 AGCACCTATGACGACCATTAC pLKO_005 517 CDS 100% 10.800 15.120 N C1orf158 n/a
3 TRCN0000430844 TACGAGATCTGGCCCGTCAAA pLKO_005 912 3UTR 100% 4.950 6.930 N C1orf158 n/a
4 TRCN0000183905 CCATTACAACCGGCATGGTTA pLKO.1 531 CDS 100% 4.950 3.960 N C1orf158 n/a
5 TRCN0000422189 GCAGATTGAGACCAAGTATTC pLKO_005 279 CDS 100% 10.800 7.560 N C1orf158 n/a
6 TRCN0000179602 GCAGATAAACTCAGAGTACGA pLKO.1 896 3UTR 100% 2.640 1.848 N C1orf158 n/a
7 TRCN0000131104 GCAGCTCAGATAGAATCAGCT pLKO.1 834 3UTR 100% 2.640 1.848 N C1orf158 n/a
8 TRCN0000147023 CTCAGAATCATCATCTGCATT pLKO.1 939 3UTR 100% 4.950 2.970 N C1orf158 n/a
9 TRCN0000147825 GAGCACTTATACTTCATCCTA pLKO.1 708 CDS 100% 3.000 1.800 N C1orf158 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09355 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_09355 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473263 ACTTCGACGTCTGGAACCAGTCTC pLX_317 51.9% 100% 100% V5 n/a
Download CSV