Transcript: Human NM_152321.4

Homo sapiens endoplasmic reticulum protein 27 (ERP27), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ERP27 (121506)
Length:
1547
CDS:
30..851

Additional Resources:

NCBI RefSeq record:
NM_152321.4
NBCI Gene record:
ERP27 (121506)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152321.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350665 GGGTTATTCAACAGCGTAATT pLKO_005 489 CDS 100% 13.200 18.480 N ERP27 n/a
2 TRCN0000322629 TCCTCACTCCCTATCCAATTT pLKO_005 1087 3UTR 100% 13.200 18.480 N ERP27 n/a
3 TRCN0000322627 CCAAATTGAGCCGTTTCATTG pLKO_005 418 CDS 100% 10.800 15.120 N ERP27 n/a
4 TRCN0000148680 CCTGGTAGACAATGAACAACT pLKO.1 359 CDS 100% 4.950 6.930 N ERP27 n/a
5 TRCN0000322626 CCTGGTAGACAATGAACAACT pLKO_005 359 CDS 100% 4.950 6.930 N ERP27 n/a
6 TRCN0000149665 GCCGTTTCATTGAGATCAACA pLKO.1 427 CDS 100% 4.950 6.930 N ERP27 n/a
7 TRCN0000322554 AGATTCATCTCCTCCTGATAA pLKO_005 511 CDS 100% 13.200 10.560 N ERP27 n/a
8 TRCN0000147594 GAAGTTGAGAAATCCTCAGAT pLKO.1 105 CDS 100% 4.950 3.960 N ERP27 n/a
9 TRCN0000128967 GAAAGCATTGATGCCACCAAA pLKO.1 402 CDS 100% 4.950 3.465 N ERP27 n/a
10 TRCN0000149165 GAGCCGTTTCATTGAGATCAA pLKO.1 425 CDS 100% 4.950 3.465 N ERP27 n/a
11 TRCN0000128392 GCAGAAATAGACCATGTGAAA pLKO.1 1445 3UTR 100% 4.950 3.465 N ERP27 n/a
12 TRCN0000191992 GCTTCTTCCAGGATTTAGAAA pLKO.1 214 CDS 100% 5.625 2.813 Y Erp27 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1008 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152321.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04753 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04753 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476665 CACTTGATCGCAACAATCCCTCTA pLX_317 50.7% 100% 100% V5 n/a
Download CSV