Transcript: Human NM_152377.3

Homo sapiens chromosome 1 open reading frame 87 (C1orf87), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C1orf87 (127795)
Length:
2028
CDS:
109..1749

Additional Resources:

NCBI RefSeq record:
NM_152377.3
NBCI Gene record:
C1orf87 (127795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152377.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053901 CCCGAGATGTCTCAAAGCAAA pLKO.1 1348 CDS 100% 4.950 3.960 N C1orf87 n/a
2 TRCN0000053898 GCCTGCAAAGATCCTCTGAAA pLKO.1 1432 CDS 100% 4.950 3.960 N C1orf87 n/a
3 TRCN0000423779 TGAGAGTCATGGCACTCATAG pLKO_005 945 CDS 100% 10.800 7.560 N C1orf87 n/a
4 TRCN0000053899 CCTCTACAGTTACCAACAGTT pLKO.1 790 CDS 100% 4.950 3.465 N C1orf87 n/a
5 TRCN0000053902 GTTCCCATTAACTTCACTGAT pLKO.1 307 CDS 100% 4.950 3.465 N C1orf87 n/a
6 TRCN0000053900 GCATCAGATTATCCACAGCAA pLKO.1 895 CDS 100% 2.640 1.848 N C1orf87 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152377.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13134 pDONR223 100% 25.2% 25.2% None 1_1224del n/a
2 ccsbBroad304_13134 pLX_304 0% 25.2% 25.2% V5 1_1224del n/a
3 TRCN0000469922 TACACGATACCCCGTGCTGAGACC pLX_317 65.4% 25.2% 25.2% V5 1_1224del n/a
Download CSV