Transcript: Human NM_152380.3

Homo sapiens T-box transcription factor 15 (TBX15), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TBX15 (6913)
Length:
3445
CDS:
270..1760

Additional Resources:

NCBI RefSeq record:
NM_152380.3
NBCI Gene record:
TBX15 (6913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018023 CGAGTTCATGTGATTCGCAAA pLKO.1 678 CDS 100% 4.050 5.670 N TBX15 n/a
2 TRCN0000018027 CACAACCCTTACAACCTGTAT pLKO.1 1485 CDS 100% 4.950 3.960 N TBX15 n/a
3 TRCN0000018026 CCATGATATTGGAACTGAAAT pLKO.1 329 CDS 100% 13.200 9.240 N TBX15 n/a
4 TRCN0000084361 GTAATCTAAACCTCTCTGATT pLKO.1 1126 CDS 100% 4.950 3.465 N Tbx15 n/a
5 TRCN0000333929 GTAATCTAAACCTCTCTGATT pLKO_005 1126 CDS 100% 4.950 3.465 N Tbx15 n/a
6 TRCN0000018025 CCATCCCTGATCTCAGGAATA pLKO.1 1281 CDS 100% 10.800 6.480 N TBX15 n/a
7 TRCN0000018024 CCTATCAGAATCAGCAGATTA pLKO.1 796 CDS 100% 13.200 6.600 Y TBX15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07035 pDONR223 100% 99.9% 100% None 1392C>T n/a
2 TRCN0000468373 TTTGGCTTTTTCACCGCCTACTGA pLX_317 26.9% 99.9% 100% V5 1392C>T n/a
Download CSV