Transcript: Human NM_152384.3

Homo sapiens Bardet-Biedl syndrome 5 (BBS5), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
BBS5 (129880)
Length:
3159
CDS:
61..1086

Additional Resources:

NCBI RefSeq record:
NM_152384.3
NBCI Gene record:
BBS5 (129880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152384.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118758 GCTCTGACAGTCGAACAAATT pLKO.1 892 CDS 100% 13.200 18.480 N BBS5 n/a
2 TRCN0000118760 CGGTTACAATTGCATATTGAA pLKO.1 273 CDS 100% 5.625 7.875 N BBS5 n/a
3 TRCN0000412419 CAAGATCGTGAACCTGTATTT pLKO_005 988 CDS 100% 13.200 9.240 N BBS5 n/a
4 TRCN0000118761 CCCATATTTGGAGTTGATTAT pLKO.1 841 CDS 100% 13.200 9.240 N BBS5 n/a
5 TRCN0000248515 TATCTGCAAATTCGTTCAATA pLKO_005 667 CDS 100% 13.200 9.240 N Bbs5 n/a
6 TRCN0000122011 GTGGATATGTTCTTGGCTTTA pLKO.1 746 CDS 100% 10.800 7.560 N BBS5 n/a
7 TRCN0000428212 TTAATGTCAGTATACCATATC pLKO_005 650 CDS 100% 10.800 7.560 N BBS5 n/a
8 TRCN0000118759 CCTGGAGAAGTCCTTATTGAT pLKO.1 136 CDS 100% 5.625 3.938 N BBS5 n/a
9 TRCN0000122591 CAGGGCAATTTAGGAACCTTT pLKO.1 580 CDS 100% 4.950 3.465 N BBS5 n/a
10 TRCN0000118757 GCACTAATTCAGAACAAGCAA pLKO.1 493 CDS 100% 3.000 2.100 N BBS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152384.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09522 pDONR223 100% 99.9% 100% None 729A>G n/a
2 ccsbBroad304_09522 pLX_304 0% 99.9% 100% V5 729A>G n/a
3 TRCN0000465818 CAACAGGACTGTTGGACGCTCACC pLX_317 32.1% 99.9% 100% V5 729A>G n/a
Download CSV