Transcript: Human NM_152386.4

Homo sapiens sphingosine-1-phosphate phosphatase 2 (SGPP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SGPP2 (130367)
Length:
4983
CDS:
61..1260

Additional Resources:

NCBI RefSeq record:
NM_152386.4
NBCI Gene record:
SGPP2 (130367)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152386.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051786 GCTGAATCTCTCCCTGTTATT pLKO.1 970 CDS 100% 13.200 18.480 N SGPP2 n/a
2 TRCN0000051784 GCAAGTATTATACTCATGGTT pLKO.1 1101 CDS 100% 3.000 4.200 N SGPP2 n/a
3 TRCN0000358970 TGGAATATTGACCCTTATTTA pLKO_005 391 CDS 100% 15.000 10.500 N SGPP2 n/a
4 TRCN0000358971 CTATGGACAGATACCAGTATC pLKO_005 602 CDS 100% 10.800 7.560 N SGPP2 n/a
5 TRCN0000358989 TGTATCCAAGCCCGCTGAATC pLKO_005 957 CDS 100% 10.800 7.560 N SGPP2 n/a
6 TRCN0000051785 CGTCGTGAAGAATTATTTCTA pLKO.1 297 CDS 100% 5.625 3.938 N SGPP2 n/a
7 TRCN0000051787 GAAGTGTTCTACATCACGTTT pLKO.1 355 CDS 100% 4.950 3.465 N SGPP2 n/a
8 TRCN0000051783 CCCTTATTTATCCAGAAGATT pLKO.1 402 CDS 100% 5.625 3.375 N SGPP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3208 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152386.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09526 pDONR223 100% 99.7% 100% None 450A>G;471C>T;945A>G n/a
2 ccsbBroad304_09526 pLX_304 0% 99.7% 100% V5 450A>G;471C>T;945A>G n/a
3 TRCN0000481653 GCCGAATATTACTCTCAGTAGGGC pLX_317 32.8% 99.7% 100% V5 450A>G;471C>T;945A>G n/a
Download CSV