Transcript: Human NM_152435.3

Homo sapiens amidohydrolase domain containing 1 (AMDHD1), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
AMDHD1 (144193)
Length:
2226
CDS:
69..1349

Additional Resources:

NCBI RefSeq record:
NM_152435.3
NBCI Gene record:
AMDHD1 (144193)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432832 GGTAAACCTATTGTGATTAAA pLKO_005 1543 3UTR 100% 15.000 21.000 N AMDHD1 n/a
2 TRCN0000046959 CGTGGACAATATAGACGTATT pLKO.1 743 CDS 100% 10.800 15.120 N AMDHD1 n/a
3 TRCN0000417219 CACATGCATTTGACATATAAA pLKO_005 1520 3UTR 100% 15.000 10.500 N AMDHD1 n/a
4 TRCN0000419483 ACATCCAATTAGTTCACAAAT pLKO_005 1572 3UTR 100% 13.200 9.240 N AMDHD1 n/a
5 TRCN0000419521 ATGTTAGATGAAGGAGTAATA pLKO_005 1032 CDS 100% 13.200 9.240 N AMDHD1 n/a
6 TRCN0000419460 GATATAGGGTTACAGATTAAC pLKO_005 822 CDS 100% 13.200 9.240 N AMDHD1 n/a
7 TRCN0000046958 GCCACCATCAATGCAGCTTAT pLKO.1 1164 CDS 100% 10.800 7.560 N AMDHD1 n/a
8 TRCN0000432396 GTGGAGTGCAAGAGTGGATAT pLKO_005 525 CDS 100% 10.800 7.560 N AMDHD1 n/a
9 TRCN0000046961 GCCTACATGCTGAGACTGAAA pLKO.1 993 CDS 100% 4.950 3.465 N AMDHD1 n/a
10 TRCN0000046962 GCTGCTGATGACATCATCAAT pLKO.1 675 CDS 100% 0.563 0.394 N AMDHD1 n/a
11 TRCN0000046960 CTGGTGAAAGAGTTCACGAAT pLKO.1 346 CDS 100% 0.495 0.347 N AMDHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09609 pDONR223 100% 99.6% 99.7% None (many diffs) n/a
2 ccsbBroad304_09609 pLX_304 0% 99.6% 99.7% V5 (many diffs) n/a
3 TRCN0000491806 TCGGTACGTCCCATTGGTAGTATC pLX_317 27.8% 99.6% 99.7% V5 (many diffs) n/a
Download CSV