Transcript: Human NM_152445.3

Homo sapiens FAM161 centrosomal protein B (FAM161B), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
FAM161B (145483)
Length:
3992
CDS:
69..2012

Additional Resources:

NCBI RefSeq record:
NM_152445.3
NBCI Gene record:
FAM161B (145483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152445.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130487 GAAGTCTCAAGCAATGTCCAA pLKO.1 1532 CDS 100% 2.640 3.696 N FAM161B n/a
2 TRCN0000130742 GAACCGGAACAATGACCGTAA pLKO.1 1628 CDS 100% 4.050 3.240 N FAM161B n/a
3 TRCN0000365114 ATCTCGTATCACTTGCTTAAT pLKO_005 1993 CDS 100% 13.200 9.240 N FAM161B n/a
4 TRCN0000370168 TGACTCAACTGGGAGCATTTA pLKO_005 251 CDS 100% 13.200 9.240 N FAM161B n/a
5 TRCN0000365115 ACAACCTTCCCTCCAACATTC pLKO_005 475 CDS 100% 10.800 7.560 N FAM161B n/a
6 TRCN0000365116 AGGAAATGAAGCAGCGAATAC pLKO_005 1678 CDS 100% 10.800 7.560 N FAM161B n/a
7 TRCN0000365117 CCTATCGCCTCCTCTAGTAAC pLKO_005 1062 CDS 100% 10.800 7.560 N FAM161B n/a
8 TRCN0000370167 GCTCCTGGGCATCATCCATTA pLKO_005 556 CDS 100% 10.800 7.560 N FAM161B n/a
9 TRCN0000365118 TTGAGTCATGGCTACTGTTAG pLKO_005 2094 3UTR 100% 10.800 7.560 N FAM161B n/a
10 TRCN0000130905 GCCAAGGATCTAGCCAAGAAA pLKO.1 1728 CDS 100% 5.625 3.938 N FAM161B n/a
11 TRCN0000128789 CCAGGTTCCAAGAAACTACAA pLKO.1 1870 CDS 100% 4.950 3.465 N FAM161B n/a
12 TRCN0000127877 GCAGCTAACTTGGGTTTGAGT pLKO.1 2051 3UTR 100% 3.000 2.100 N FAM161B n/a
13 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 2166 3UTR 100% 4.950 2.475 Y GJD4 n/a
14 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 2166 3UTR 100% 4.950 2.475 Y C9orf85 n/a
15 TRCN0000215992 CTATCTCTTTGAACAAGTTAC pLKO.1 1709 CDS 100% 10.800 7.560 N Fam161b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152445.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09622 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_09622 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479313 CCTCCTGATATCTTGTGGACACAT pLX_317 23.3% 100% 100% V5 n/a
Download CSV