Transcript: Human NM_152486.3

Homo sapiens sterile alpha motif domain containing 11 (SAMD11), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SAMD11 (148398)
Length:
2557
CDS:
91..2136

Additional Resources:

NCBI RefSeq record:
NM_152486.3
NBCI Gene record:
SAMD11 (148398)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245188 GAGAGTACACTCGGGTCTTCA pLKO_005 1766 CDS 100% 4.950 6.930 N SAMD11 n/a
2 TRCN0000245185 GTCCGCACATCCGTATCATGA pLKO_005 317 CDS 100% 4.950 6.930 N SAMD11 n/a
3 TRCN0000183007 CCGCTTTATTTCTTTCGGTTT pLKO.1 2210 3UTR 100% 4.050 5.670 N SAMD11 n/a
4 TRCN0000179816 CCGTATCATGAAGAGAAGAGT pLKO.1 327 CDS 100% 3.000 2.400 N SAMD11 n/a
5 TRCN0000245187 GCAACCTTCCCACCCTCATAT pLKO_005 404 CDS 100% 13.200 9.240 N SAMD11 n/a
6 TRCN0000245189 GAGCCACCACTCAACACAATG pLKO_005 2176 3UTR 100% 10.800 7.560 N SAMD11 n/a
7 TRCN0000245186 TGGGACGTGAACATCTCTTTC pLKO_005 358 CDS 100% 10.800 7.560 N SAMD11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476869 AGCCTGGATCTCGCGAGAATCGCG pLX_317 20.3% 72.7% 39% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14402 pDONR223 99.9% 72.6% 39% None (many diffs) n/a
3 ccsbBroad304_14402 pLX_304 0% 72.6% 39% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV