Transcript: Human NM_152512.4

Homo sapiens ENTH domain containing 1 (ENTHD1), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
ENTHD1 (150350)
Length:
2680
CDS:
222..2045

Additional Resources:

NCBI RefSeq record:
NM_152512.4
NBCI Gene record:
ENTHD1 (150350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152512.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153695 CCCAAGACTTACGTTAGCATT pLKO.1 2091 3UTR 100% 4.950 6.930 N ENTHD1 n/a
2 TRCN0000151980 CGCTAGATTACATGAAGATCT pLKO.1 1898 CDS 100% 4.950 6.930 N ENTHD1 n/a
3 TRCN0000152541 GCCAAGATGTTCATTTGCCTA pLKO.1 850 CDS 100% 2.640 3.696 N ENTHD1 n/a
4 TRCN0000153946 CCAAGGTTATTATATCCGGGA pLKO.1 566 CDS 100% 0.540 0.756 N ENTHD1 n/a
5 TRCN0000427858 CCCTTACCCTAATGGATTATC pLKO_005 442 CDS 100% 13.200 10.560 N ENTHD1 n/a
6 TRCN0000434951 AGAGATCAGATGGTATCTTTA pLKO_005 1114 CDS 100% 13.200 9.240 N ENTHD1 n/a
7 TRCN0000413612 GAGCTCAGATCAGATCTAATC pLKO_005 2027 CDS 100% 10.800 7.560 N ENTHD1 n/a
8 TRCN0000150529 GCTCATCTCTTATCACCAATT pLKO.1 1521 CDS 100% 10.800 7.560 N ENTHD1 n/a
9 TRCN0000151362 GATGTTCATTTGCCTACAGAA pLKO.1 855 CDS 100% 4.950 3.465 N ENTHD1 n/a
10 TRCN0000153162 GCAGGATTGAAACAAGAGCAT pLKO.1 828 CDS 100% 2.640 1.848 N ENTHD1 n/a
11 TRCN0000157501 GCTCTGTACCTCAAATGGGTT pLKO.1 2304 3UTR 100% 2.640 1.584 N ENTHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152512.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05039 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05039 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491628 CGCCGTTGGGCCCGGATCCAACCA pLX_317 21.3% 100% 100% V5 n/a
Download CSV